3rd Thursday Update

December 18, 2014

Yes, it's that time of year again! Tomorrow is the last day at work before we shut down for the holidays, and on that day (which is more or less devoted to departmental Christmas parties), an informal band that I put together each year roams around the site from building to building and floor to floor, stopping to play a few Christmas tunes in each work area. This will be the 19th year we've done it, and this time we're a bigger band (and I think a better one) than ever before. If everyone shows up tomorrow morning, we will have two violins, two flutes, two guitars, two string basses, two trumpets, a trombone, a clarinet, a French horn, a saxophone, and a cello.

This morning we had a bit of preview, with several of us playing for the employees of a division that was having its Christmas party a day early.

There was no real space for us to play in; we just squeezed in among their office cubicles.

Yeah, I know, we're not smiling. Playing music, especially with an audience, requires intense concentration, and intense concentration does not generally produce grins. You'll have to trust me that, somewhere deep inside, we were having fun.

Even though I organize and lead the band, I am nowhere close to being the best musician in it, and because we are using pretty elaborate arrangements this time, I am playing a harmony part rather than the melody -- which is extremely confusing if you're not used to it. Altogether, this annual event always gets me outside my comfort zone, and more so this year than ever. But getting outside our comfort zones is something we human beings need to do on a regular basis. Anyway, that's my theory. Being too comfortable is usually not a healthy thing.

Nothing ages you like getting into the habit of doing whatever is easiest.

The really challenging part of the event was making myself get out of there as soon as we were done playing. They were making waffles for us, and I figured waffles were the last thing I needed right now. That doesn't mean I didn't want them. Christmas is a tough time of year for people with diabetes.

 


A creepy fact of nature

I read today that some whales have hearts so large that a human could swim through their coronary arteries.

Maybe so. However, the fact that you can do something doesn't mean you should.

And I bet this is only possible for the healthiest whales. Before you try it, find out how many cinnamon rolls that whale has been eating. Those arteries might not actually be as roomy and clean as the ones in the picture (which I have reason to believe are part of plastic model).



Implicit questions (or net searches, anyway) answered

I like to take the search phrases that have resulted in Google referrals to this site, and reply to them as if they were questions directed at me. For all I know, they might have been.

"will low glucose kill me"

"will low blood sugar kill you"

"can low blood sugar kill you"

"how can hypoglycemia kill you"

"how low of blood sugar will kill you"

"how long does it take to die from hypoglycemia"

Clearly there is a lot of anxiety out there about hypoglycemia. Anyone, diabetic or not, can experience episodes of hypoglycemia (low blood glucose), but for most people such episodes are upsetting and unpleasant, but also infrequent and harmless. However, taking insulin (or sometimes taking other medications that reduce blood glucose levels) quite often pushes people into hypoglycemia, if they take too much for what they've been eating, and that kind of drug-induced hypoglycemia can be severe enough to cause confusion, loss of consciousness, and even death.

Death as the direct result of a severe hypoglycemic episode is actually pretty uncommon, however. Supposedly hypoglycemia can be fatal if your glucose level drops below the 30s (I'm talking about measurements in mg/dl), because in that situation the heart and brain might not be getting enough chemical energy to sustain proper functioning -- but this doesn't happen as often as people imagine. And I know people who have survived plunges into the 20s (admittedly with a lot of help from the emergency room staff).

The more pressing concern about hypoglycemia is the cumulative harm done by repeated episodes of hypoglycemia over long periods. Every such episode kills some brain and nerve cells, and many of us don't have enough of those as it is. Also, frequent hypoglycemic episodes are harmful to cardiovascular health; the exact mechanism of harm isn't clear, but the risk of severe cardiovascular "events" (heart attacks and strokes) is elevated by frequent hypoglycemia.

What can be done about this? It's easy to say "arrange to have fewer hypoglycemic episodes", but not so easy to put such a plan into practice. Researchers are working on various ways to make diabetes drugs less likely to induce hypoglycemia, but it seems to me that the only really good approach available now is to control diabetes in a way which requires less medication, and preferably none. For Type 1 patients that is impossible, but for many Type 2 patients it can be done.

" if i am diabetic why hasn't my doctor given me meds"

Because your doctor is hoping you can get this under control without meds, which is preferable for various reasons (one of those reasons is discussed above).

"is normal blood sugar the same for everyone"

There is always some individual variation in these matters, and also some variation between different ethnic populations. But the average healthy non-diabetic person gets fasting results that are something like 85 and after-meal results that are something like 125. What's tricky is to specify exactly how far you can get above those numbers before we have to stop calling it normal variability and start calling it diabetes. The diagnostic threshold is arbitrary, has changed in the past, and will probably change again.

If your doctor says you're diabetic, I think it's safe to say things have gotten far enough above normal that you shouldn't dispute the point. My experience is that most people who protest that their glucose isn't high enough for them to be "really" diabetic are kidding themselves.

"what can cause my blood sugar during the day to be within normal limits but waking up a bit to high"

While you are sleeping, your liver gradually releases stored glucose into the bloodstream to keep your blood sugar level from dropping too low (which it easily could, since you're going a long time between meals when you're asleep). The amount of glucose your liver releases would not be excessive if you weren't diabetic, but people with diabetes have a hard time processing that much of the stuff, so you tend to wake up with slightly elevated glucose.

"if you are diagnosed with type 2 diabetes in your 60's do you need to take insulin"

Not necessarily. You might not need to take anything. If you can control your blood sugar well enough without insulin, you can live without insulin. But you may have to take insulin if other methods don't bring you under adequate control.

"what it mean when your sugar is 360 but i don't have sugar"

I'm guessing that "I don't have sugar" means "I don't eat sugar" -- to which my reply is "you think you don't eat sugar".

Alas, the government allows food labels to make a meaningless distinction between "sugar" and "carbohydrate". Carbohydrates that aren't listed on food labels as "sugar" consist of sugar molecules chained together; digesting them breaks up the chains, so that the stuff enters your bloodstream as just plain sugar. It may not have been "sugar", for legal purposes, when you swallowed it, but it becomes sugar minutes later.

Rice, bread, pasta, tortillas, potatoes -- you may not think of them as sugar, but your digestive tract knows better.

"how to trick pass medical if you are diabetic"

The only two things I can think of are to slip the doctor a fake blood sample somehow, or else to get your blood glucose under control. The latter approach is probably the more useful of the two.

"after urine aunts present"

"if aunt is coming on urine sugar is possible"

The presence or absence of your parent's sisters will tell you nothing about the sugar level in your urine. You're probably thinking of ants.

It has been reported since ancient times that ants and bees are attracted to the urine of diabetes patients (because, when diabetes is out of control, excess sugar in the bloodstream leaks into the urine).

My own experience suggest that ants and bees are attracted to all manner of disgusting things, so it's best not to rely too heavily on them as a diagnostic tool. We have better methods, these days, to determine whether or not you are diabetic.



2nd Thursday Update

December 11, 2014

The storm arrived on schedule, but amazingly enough I still have electricity! I don't know how I got so lucky this time; there are a fair number of downed trees, and there are a lot of floods and power failures around the region, but my immediate neighborhood escaped.

Because we don't get a lot of rough weather, Californians have to be given pretty explicit instructions for dealing with it.

My workplace was open today, but a lot of people who live farther from the office than I do stayed home rather than take a chance of being caught on flooded roads.

I didn't feel like working out at the gym again, however nasty the weather was -- I felt as if I was overdue for a real, outdoor run. So I went outside and did it, even though it was raining hard. It's difficult to make yourself do that, because the start of the run, when you're just starting to get soaked, is pretty miserable. But the start of a run is usually pretty miserable anyway, even when the sun is shining, because you're not adjusted to it yet. And once you're soaked, you can't get any wetter, so from then one it's okay. And the hot shower afterwards is amazing.

 


Exercise and epigenetics

The health benefits of exercise are well-established as real, but poorly understood in terms of how they come about. Why, after all, should exercising have anything but a temporary effect on the body? Once you have finished a workout and allowed your heart rate to settle down to a normal level, why should anything in your body be different than it was before?

The answer, or anyway a large part of the answer, probably has to do with "epigenetics", the complicated process by which whatever genes we possess are activated and deactivated at various times. "Genetics" simply determines what set of genes you inherited at the moment of conception; "epigenetics" determines which of those genes are turned on and which are turned off, at any time. And epigenetics is affected by what you do, not just by who you are.

A team of researchers in Sweden decided to investigate the effect of exercise on the epigenetics of muscle cells. "It is well-established that being inactive is perilous, and that regular physical activity improves health, quality of life and life expectancy. However, exactly how the positive effects of training are induced in the body has been unclear. This study indicates that epigenetics is an important part in skeletal muscle adaptation to endurance training."

The researchers chose what seems to me like a very odd method of investigating the matter: instead of comparing the muscles of active people to those of sedentary people, they compared used and unused muscles, by asking their test subjects to do "one-legged cycling". That is, pedal the bike in such a way that one leg is doing all the work and the other is just along for the ride. I've never tried it, but it sounds hard to do.

Anyway, they compared active and inactive leg muscles to see what was going on in there in regard to epigenetic changes ("methylation") within the muscle cells. It turned out that plenty was going on in the exercised muscles that wasn't going on in the passive ones. "Results show that there were strong associations between epigenetic methylation and the change in activity of 4000 genes in total. Genes associated to genomic regions in which methylation levels increased, were involved in skeletal muscle adaptation and carbohydrate metabolism, while a decreasing degree of methylation occurred in regions associated to inflammation."

My goodness. 4000 genes is a lot of genes. Usually, when researchers study the effect of exercise on human genes, they are hoping to find a way to create a drug which modifies genes in the same way exercise does. But if 4000 different genes are involved, creating a drug which modifies all of them in the right way might not be easy to accomplish. Maybe we'll have to give up on the dream of developing an "exercise pill", and simply do the damned exercise.

 


Another cure for diabetes (in mice)!

However difficult it may be to treat diabetes in human beings, researchers can always seem to find a way to cure diabetic mice. I think I have reported at least half a dozen such cures in this blog. Well, here's another.

Researchers at Indiana University have figured out a way to create a new peptide (a kind of junior protein -- hormones are typically classed as peptides) which cures diabetes, at least in mice. This artificially created peptide acts as a hormone -- or rather it acts as three hormones, targeting the hormone receptors for glucagon, GLP-1, and GIP. Anyway, it is an effective treatment for diabetes and obesity. It is if you're a rodent, at least. Now human trials are needed, to establish not only the effectiveness of the new peptide but the safety of it. (If it has to carry a warning label saying "WARNING: YOUR CHILDREN WILL BE LIZARDS", it might be a tough sell.) Another issue to consider: peptides are broken down by digestion, so the drug presumably couldn't be taken orally. You would need to inject it, which isn't usually the path to popularity.

Here's a picture of the new peptide, in case you want to experiment with the design yourself, and come up with an indigestible version of it.

 


I get e-mail

Here's a message I received and do not trust....

Weird 30-Second Trick to deal with Diabetes.

From Diabetes Miracle

Forget anything you've ever been told about Diabetes...
Because this 'average' man's discovery has not only CURED 24,497 people of their diabetes in just 2 weeks, but it has the potential to wipe out the _$245 billion diabetes Pharma industry FOR GOOD.

And get this - it has NOTHING to do with insulin, exercise, diet or anything else you've heard in the past. It's all based on latest breakthrough research that Big Pharma is going Stir Crazy to hide from you.

Click Here To Find Out What All The Fuss Is About...

If you would no longer like to receive messages from us, please click here.

It does not build my confidence when a message from a stranger instructs me to forget everything I know about a subject important to me, uses BLOCK CAPITALS for emphasis, suggests that I can destroy a major industry by believing whatever story they are telling, and then urges me to Click Here.

If there's an industry I want to destroy, it's not the $245 billion Pharma industry, it's the penny-ante racket that sends out messages like this one.

 

1st Thursday Update

December 4, 2014

 


The fat paradox

For years it was unquestioned wisdom that fat in the diet, particularly saturated fat, was bad for our cardiovascular health (because it supposedly increased fat in the bloodstream). Certainly this idea appeals to our common sense, but it apparently isn't true. The latest paradoxical input on the subject comes from a study at Ohio State University which found that "Doubling or even nearly tripling saturated fat in the diet does not drive up total levels of saturated fat in the blood, according to a controlled diet study. However, increasing levels of carbohydrates in the diet during the study promoted a steady increase in the blood of a fatty acid linked to an elevated risk for diabetes and heart disease."

The result is counterintuitive, obviously. It may help you make sense of it to remind yourself that the body can make fat out of whatever you eat -- and apparently it is very good at making fat out of carbohydrate. Cutting carbohydrate intake apparently makes the body burn fat for energy rather than storing it; increasing carbohydrate intake apparently makes the body turn the carbohydrate into fat and save it up for the winter.

I expect this new study will be angrily denounced, as other such studies have been, but the saturated-fat-is-evil campaign sure looks as if it's on the losing side of history.

 


A complicated business, this "genetics"!

It's amazing to me, given how complicated DNA and its coding scheme is, that we've been able to figure out anything at all about it. And yet, geneticists have figured out a great deal, and are constantly learning more.

Most of us think of genetics as having to do with our "inheritance" -- the genes encoded in our DNA are what make us look like our parents. In other words, we tend to assume that our genes did their job while we were gestating in the womb, and while we were developing into adults. But by now our genes have retired; they might help the police build a case against us if we kill somebody, but apart from that they have no further role to play in our lives. We think of our genetic code as being like the recipe from which a cake was made: the recipe is the reason the cake tastes the way it does, but once the cake is baked the recipe has done all it can.

Actually, the genes encoded in our DNA are more like the software that runs our computers. For as long as the computer still works, the instructions contained in the software continue to control how it works. For as long as we are alive, every cell in our bodies is making use of our genes (copying them, "expressing" them, turning them on and off) to control the way our bodies work.

Like computer software, which can be broken down into long sequences of two digits (0 or 1), the instructions of the genetic code break down into long sequences of four letters (A, C, G, or T). Those letters represent the four molecules which can be found on the steps of the DNA staircase. The molecules are called "base pairs" -- each step on the staircase always consist of a pair of these molecules. (T always pairs with A, and C always pairs with G).

The letters A, C, G, and T stand for adenine, cytosine, guanine, and thymine, but each of these molecules serves merely as a kind of alphabetic symbol in the genetic code. A string of these symbols is interpreted as a "word", a word which instructs the cell on how to assemble a particular protein. Such words are called genes.

For example, the gene identified as "EIF2AK3" is represented by this sequence: TCAGCACTCAGATGGAGAGAGTCAGG. (When you only have four letters to work with, the words have to be pretty long in order to support a large vocabulary of unique words.) Another gene called "RPLP0" is represented as GGAAACTCTGCATTCTCGCTTCCT.

The cartoonist Zach Weiner has his own take on this four-letter scheme:

Of course, one big problem with this coding scheme is that if a copying error (at the time of your conception) left you with a misspelling of one of these "words", you have a faulty gene which doesn't give your cells quite the right chemical instructions, and you end up with a defective protein which operates incorrectly or not at all. Genetic diseases are the result of such spelling errors. For example, if a misspelled gene make your cells unable to create a protein that is crucial to the clotting of blood, you will suffer from hemophilia all your life. A more subtle kind of genetic defect can impair the body's ability to detect and destroy cancer cells -- if you have such a defect, then you face an increased risk of developing a particular form of cancer, but if you get a lucky break you'll never find that out. (If a cancer of that type never gets started in you, your body's inability to suppress it won't have any consequences.)

Of course, when we talk about genetic diseases, we're talking about the "recipe" aspect of genetics -- the inventory of genes we're given at conception, and which we're stuck with forever. That aspect of genetics has always been given a lot of attention, because for a long time it was the only aspect of genetics that scientists were able to study. The dynamic aspect of genetics -- the processes by which genes are activated and deactivated -- is now starting to be explored, as geneticists develop better tools and methods. As more and more is learned about the way genes get turned on and off (often in reaction to our lifestyle choices!), the operation of genes is revealed as more and more complex.

I read a report today about Danish research on the way genes are activated in muscle cells by exercise -- and specifically by different kinds of exercise, for different periods of time. It turns out to be a ridiculously complicated picture, because thousands of genes in muscle cells are affected by exercise. The Danish researchers are putting together a large supply of data on how specific genes are affected by specific kinds of exercise. Here, we see that the gene I mentioned earlier as "EIF2AK3" (you know, the one that's that has the code TCAGCACTCAGATGGAGAGAGTCAGG) is greatly enhanced by strength-training exercise, but not by endurance exercise.

The researchers are hoping this kind of basic data-gathering will eventually lead to important discoveries about why certain health problems are caused or worsened by lack of exercise. They are also hoping (of course!) that this will lead to drug therapies which can give people the health benefits of exercise even if they remain entirely sedentary. Obviously that possibility has "billion-dollar patent" written all over it, even if it seems like a long shot when such a wide array of genes is involved.

Now that so much information is becoming available about genes and gene expression, modern pharmaceuticals are often designed to enhance or suppress a given gene (and the protein it codes for), for the sake of combating a disease. The trouble is that enhancing or suppressing a gene might alleviate one health problem while causing another.

For example, a class of diabetes drugs known as TZDs (Avandia is an example) enhances the action of a protein known as PPAR-gamma. This raised alarm bells for some researchers, who pointed out that PPAR-gamma is also enhanced in bladder tumors. Some preliminary studies (on rats) seemed to show that such drugs do indeed increase the risk of bladder cancer. However, a new, larger study (on humans who use these drugs) found no link to bladder cancer. Apparently, it is only a harmless coincidence that bladder tumor cells and TZDs both enhance PPAR-gamma. However, the fact that the concern was a false alarm in this case does not mean that messing with gene expression is never a risky business.

As I said at the outset, genetics is complicated, and any change to gene expression could end up having both welcome and unwelcome results. We will need to proceed with caution. I think we're going to have to keep doing real exercise (instead of taking exercise pills) for the foreseeable future.

 


Older Posts:

November 2014
October 2014
September 2014
August 2014
July 2014
June 2014
May 2014
April 2014
March 2014
February 2014
January 2014
December 2013
November 2013
October 2013
September 2013
August 2013
July 2013
June 2013
May 2013
April 2013
March 2013
February 2013
January 2013
December 2012
November 2012
October 2012
September 2012
July 2012
June 2012
May 2012
April 2012
March 2012
February 2012
January 2012
December 2011
November 2011
October 2011
September 2011
August 2011
July 2011
June 2011
May 2011
April 2011
March 2011
February 2011
January 2011
December 2010
November 2010
October 2010
September 2010
August 2010
July 2010
June 2010
May 2010
April 2010
March 2010
February 2010
January 2010
December 2009
November 2009
October 2009
September 2009
August 2009
July 2009
June 2009
May 2009
April 2009
March 2009
February 2009
January 2009
December 2008
November 2008
October 2008
September 2008
August 2008
July 2008
June 2008
May 2008
April 2008
March 2008
Jan/Feb 2008